Nopus embryo, we first attempted to find genes involved in releasing

Nopus embryo, we first attempted to find genes involved in releasing LMC.The first candidate gene we examined was mNanog, which encodes a homeodomain protein and is efficiently expressed in mammalian embryonic stem (ES)/induced pluripotent stem (iPS) cells [10?2]. Our preliminary experiments revealed that in the presence of Activin A treatment, mNanog injection promotes AC elongation and some mesodermal gene expression even at the late gastrula stage (data not shown). We also unexpectedly found that mNanog 1676428 injection induces AC elongation without Activin A treatment and could promote the expression of dorsal mesoderm genes such as chd, gsc, and xlim-1 in AC. Further experiments revealed showed that mNanog also weakly promotes Activin/nodal signaling and inhibits BMP signaling. Together, these data indicated that mNanog modulates both these signaling pathways to induce the dorsal mesoderm cell fate in Xenopus AC, suggesting a novel function for mNanog in embryogenesis.Materials and Methods PlasmidsThe mNanog gene was amplified by RT-PCR with mouse cDNA (from mouse ES D3 cell line (American Type Culture Collection(ATCC)). All experiments with the mouse ES cells were approvedDorsal Mesoderm-Inducing Activity of Nanogby the institutional ethics committee (Graduate Schools of Arts and Sciences, University of Tokyo: #19-19 and #23-10). mNanog/SK was made by inserting 25837696 the amplified fragment of mNanog into the EcoRV site of pBluescriptII SK-. For injection, we inserted the EcoRI-XhoI fragment of mNanog/SK into the EcoRIXhoI site of pCS2 to construct mNanog/CS2. dnALK4/CS2, Xnr2/CS2, Xnr5/CS2, cmXnr1/CS2, cmXnr2/CS2, and Xvent2/CS2 were also used for microinjection [3,13?6]. For lineage tracing, we used pCS2-lacZ.MicroinjectionMicroinjecion was performed using a picojector (Harvard Medical Instruments). RNA for injection was synthesized with the mMESSAGE BIBS39 chemical information mMACHINE SP6 kit (Ambion/Applied Biosystems). Injected embryo was obtained by artificial fertilization and dejellied with 4.6 L-cysteine hydrochloride solution. Injection was performed in 5 Ficoll/1 X Steinberg’s Solution (SS). Injected embryos were cultured in 0.1 X SS solution. Xenopus maintenance was carried out in compliance with institutional regulations and all Xenopus experiments were approved by the institutional ethics committee noted above (#21-10 and #24-8).xlim-1: CCCATCTAGTGACGCTCAGAGG and CCACACTGCCGTTTCGTTC; Cer: CCACAGAATACAAGCCATGG and AGCTTCACACGTGCATTCC; mNanog: GGCCCTGAGGAGGAGGAGAAC and TGCAAGCGGTGGCAGAAAAAC; EF1a: CAGATTGGTGCTGGATATGC and ACTGCCTTGATGACTCCTAG; BMP4: TTTCCCTTGGCTGATCACCTAAAC and TCAACGGCACCCACACCC. Xnot: ATA Terlipressin manufacturer CATGGTTGGCACTGA and CTCCTACAGTTCCACATC. ms-actin: GCTGACAGAATGCAGAAG and TTGCTTGGAGGAGTGTGT. NCAM: CACAGTTCCACCAAATGC and GGAATCAAGCGGTACAGA. Xnrp-1: GGGTTTCTTGGAACAAGC and ACTGTGCAGGAACACAAG.In situ hybridizationEmbryos were bleached in hydrogen peroxide-methanol before fixation in MEMFA (formaldehyde-MOPS solution) and dehydration with ethanol. Rehydrated embryos were hybridized with DIG-labeled probe for 24 h at 60uC. Embryos were then incubated with 20006 anti-DIG antibody (Roche) for 12 h, washed 5 times, and then visualized by reaction in NBT/BCIP solution (Roche).Animal cap assaymRNA was injected into the animal pole region of 2-cell-stage embryos. ACs were dissected at the late blastula stage (Stage 9), and then cultured to the appropriate stage with/without treatment with 10 ng/ml of Activin A. The shape of treated ACs was observed at about 12 h.Nopus embryo, we first attempted to find genes involved in releasing LMC.The first candidate gene we examined was mNanog, which encodes a homeodomain protein and is efficiently expressed in mammalian embryonic stem (ES)/induced pluripotent stem (iPS) cells [10?2]. Our preliminary experiments revealed that in the presence of Activin A treatment, mNanog injection promotes AC elongation and some mesodermal gene expression even at the late gastrula stage (data not shown). We also unexpectedly found that mNanog 1676428 injection induces AC elongation without Activin A treatment and could promote the expression of dorsal mesoderm genes such as chd, gsc, and xlim-1 in AC. Further experiments revealed showed that mNanog also weakly promotes Activin/nodal signaling and inhibits BMP signaling. Together, these data indicated that mNanog modulates both these signaling pathways to induce the dorsal mesoderm cell fate in Xenopus AC, suggesting a novel function for mNanog in embryogenesis.Materials and Methods PlasmidsThe mNanog gene was amplified by RT-PCR with mouse cDNA (from mouse ES D3 cell line (American Type Culture Collection(ATCC)). All experiments with the mouse ES cells were approvedDorsal Mesoderm-Inducing Activity of Nanogby the institutional ethics committee (Graduate Schools of Arts and Sciences, University of Tokyo: #19-19 and #23-10). mNanog/SK was made by inserting 25837696 the amplified fragment of mNanog into the EcoRV site of pBluescriptII SK-. For injection, we inserted the EcoRI-XhoI fragment of mNanog/SK into the EcoRIXhoI site of pCS2 to construct mNanog/CS2. dnALK4/CS2, Xnr2/CS2, Xnr5/CS2, cmXnr1/CS2, cmXnr2/CS2, and Xvent2/CS2 were also used for microinjection [3,13?6]. For lineage tracing, we used pCS2-lacZ.MicroinjectionMicroinjecion was performed using a picojector (Harvard Medical Instruments). RNA for injection was synthesized with the mMESSAGE mMACHINE SP6 kit (Ambion/Applied Biosystems). Injected embryo was obtained by artificial fertilization and dejellied with 4.6 L-cysteine hydrochloride solution. Injection was performed in 5 Ficoll/1 X Steinberg’s Solution (SS). Injected embryos were cultured in 0.1 X SS solution. Xenopus maintenance was carried out in compliance with institutional regulations and all Xenopus experiments were approved by the institutional ethics committee noted above (#21-10 and #24-8).xlim-1: CCCATCTAGTGACGCTCAGAGG and CCACACTGCCGTTTCGTTC; Cer: CCACAGAATACAAGCCATGG and AGCTTCACACGTGCATTCC; mNanog: GGCCCTGAGGAGGAGGAGAAC and TGCAAGCGGTGGCAGAAAAAC; EF1a: CAGATTGGTGCTGGATATGC and ACTGCCTTGATGACTCCTAG; BMP4: TTTCCCTTGGCTGATCACCTAAAC and TCAACGGCACCCACACCC. Xnot: ATA CATGGTTGGCACTGA and CTCCTACAGTTCCACATC. ms-actin: GCTGACAGAATGCAGAAG and TTGCTTGGAGGAGTGTGT. NCAM: CACAGTTCCACCAAATGC and GGAATCAAGCGGTACAGA. Xnrp-1: GGGTTTCTTGGAACAAGC and ACTGTGCAGGAACACAAG.In situ hybridizationEmbryos were bleached in hydrogen peroxide-methanol before fixation in MEMFA (formaldehyde-MOPS solution) and dehydration with ethanol. Rehydrated embryos were hybridized with DIG-labeled probe for 24 h at 60uC. Embryos were then incubated with 20006 anti-DIG antibody (Roche) for 12 h, washed 5 times, and then visualized by reaction in NBT/BCIP solution (Roche).Animal cap assaymRNA was injected into the animal pole region of 2-cell-stage embryos. ACs were dissected at the late blastula stage (Stage 9), and then cultured to the appropriate stage with/without treatment with 10 ng/ml of Activin A. The shape of treated ACs was observed at about 12 h.